Summary
Transcript IDgene_000027676
Gene IDTTHERM_00334410
Length508 bp
Sequence
ATAGTGGATGATATTTCTAAACTTAATATTGATCTAGCCTTTCCTGAAGGTAAGAATCTTGGTATTACTAAAAATAAAATTAAAGTAGAAGCCACATTTTCCAGTAAAAAACCAATATCATTTACCACTCGAATTGAGTTTTATGATGATGCAGAAAGAAGCTATGATATATAAATTTCAGGCACTACAGATAATTCTCTTTTTACAAACTACTCCTATTTCTAGAGATGTGCTGGAGAGTTTAAAATTGATTTAGAGCATGACAGATCTCCATTAAAGCTTGAAGTAGATGAAGATGATTTGGATTCAATAGATGGACTCTCAGATGGTAGGGTTGGCAAAGCTGCAGCTAAAAAAAAGGTAACAGGAGGAGCTTAAAGCGTCGTTTCAGCAAAGACCCTCTCATCTTATGGCTCTTCTAAATCGACTAAATCATTGCTAGGATATTCTCCTATTCCAACATAGTATTTAGAATAAAATGTAGAATTTTTATGCAGATGGCTTAACT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,790.0 L-21,484.1 L-31,755.1 S-0866.7 S-31,083.7
S-6663.4 S-9410.3 S-12470.7 S-15689.3 S-24912.9
C-0997.5 C-2715.9 C-4643.3 C-6239.8 C-8658.3
C-101,094.7 C-121,493.8 C-14705.1 C-16886.8 C-181,016.6