Summary
Transcript IDgene_000027683
Gene IDTTHERM_00334510
Length1889 bp
Sequence
AAAGCAAAGCCATTATAAATAAAAATAGACATATTGATAGTTCAAAATGCACGGAAAGAGAAAGAAAGATGTGAGACCTCTAACAGAAGAAGAGAGAAAGAAAACAGAAGAACAAGGAGAAAAAATTATTGGCTTGATTAACGAATTCTTAAGTATCCGCCATGGAAAGAAACCTGTCAATAACCCAGGAGAATATTGTGATTTAGTTGCTACAATGTGTCCTGATCTTCCTACAATTTATAACTACAAGCGTGAAGTTTTAATCAAATAATTTAAAGAAACTAAAAACCCAAAGGATTAATATAAAGCATTGATGAATGAACTATAACTTGTAACAGGATTACTCAAAAAATCACCTAAAAGTTATTCGTTATGGTCATACAGATAATGGCTCGTCCTCTAATGCAGAGAACTTGAAAGACTCTATAATAAGCTAAAAGCAGCAAAAGAAGCTTAATTAAAAAAACTTTTAGAAGAGCAATAGCAAGATGGATAACAAATTTAAAAAGAAGATTTATTAAAGTAATAAGAAGCTGAGGAACCTATTCCCCAAGTCGTTGAACTAGAATTAAAGCTTTGCAATAAAATGTTAGACATGGATGAAAGAAATTTCCATTGCTGGAATTACAGAAATTGGCTTATAAACGACGTTGAAAAGAATAGTTTGAATTACATAGAACGTGAAATCACTTATACTTAATAGAAATACGAAAATAACTTTTCTAACTTTTCAGCACTCCACTTCCGCTCTAAAAATTTAATCAAAAAGTATGATTAAGATCTTGAGTCTCTTTACAAATCTGTTTCTACTTCTCCTGAAGAAGAACAAAAAAATTTAAAATCTAGGATACGTGAGTTGACCTAATTTAAAATACCTCTATAAAACATCAAAGACGAACTTGAGCTCATCAAAAATGCTATTTTTATTTAACCTAATGAATAAGGTGTTTGGCTTTATCATAAATGGTTAGTAAGTCTGCTAGTACCTTTCCGCTTTATTTCTGTTAATCCAGTGAATAAAGAAAACACTACACTTCAAATTACTTGCTCTTCAAAGATCATCAGTAATAATTTAGCATCAACTATATAGCTTTATGATCAAACTGGAAGTCCTGTCAACAATTTCACAATTGAGGAAGTAAGAAATTAAGTTGGTCAAGTCTTTAATATCAAAGCTGATAAATAAATATAGAAAGTAGTAGTTTCTTAGCCTTAAAATATATAAATGTAAGTTATAGACTACTAAATTTCAAAAAGAAACTTAATTTCTTCTGAATTTGTATTGCAAGAATGCAAATAAAAATATAAATTACAAAAATTAGATGACCAGGATTATCAATTTAGCGAAGTAGCCTATCAAATTCTTTTAGAAGAATAATAATTTGTTGATGAAGTTATAGAAAATGAAAAATAAAGCAAATTTGCACATTTCCATAAGCTTTACTTAATTCAAGTTAAATAAGGACTTGATTTGATTTTTAAAACTGACCAACATCATCTAAGCTTAGAATCTACTTAAAACATAATAAAAGTCATTGAGAGTTTGAACTCTATTGCTAAAAAGCAAACAAACTACCTAAAAAATTTAGAGAGTCAATATTAATCTCTTTTATCACTTTAACAAACTCTTGAAAAGCAGAGCAGTGGCTAATAAATAGAAAAAATATCTCTTCCATCTTCCCCTACTTACGAAATCGATCTTTTCCTTCCTTATCACTCTCTATTATAATAATGAGTGAAAAATAAATTTATAATTTAATCAATTAGATAAAAAATTATACACGTTTGAGTGATAAAATTTTTATTGAACAAAATTTTAAACACAAAGAAGTAAGTCTCTAATATTTGCAAATATTCTTTTAAAGAATCTCTATCTATATGTAAAATAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,459.8 L-22,926.7 L-33,084.5 S-05,199.8 S-33,512.6
S-64,261.8 S-94,163.3 S-124,575.5 S-155,134.9 S-246,436.0
C-01,555.6 C-21,132.4 C-44,194.4 C-61,776.8 C-81,705.1
C-101,984.5 C-121,757.9 C-141,764.1 C-161,987.0 C-182,595.5