Summary
Transcript IDgene_000027717
Gene IDTTHERM_00338450
Length332 bp
Sequence
GAATTATTTTTCATTTTTATGATAAATCTTTTATTTTCTCAATCAAATCCTTTATATTATATTAACTAATTAACTCATCACCTTATTATATGCTCCAAACTTACTCGCGGTTATGACCAGGGTTGATAACATATACTGTAAATATATTGCTTTGATTTGATTTGATTTACTCAGAAACTTAAATCTTTAATTACTAGTTAATCTACAAATTTGTTAAATTATAAGCCTCTATAATATTCTATTCTGTAGAATGCTCTATGTAAATCTTCATTTTAGGGTTATTTTTACCACTGCAGCCACCCATGTTCTAAATAAGCTTATTCTTTTCTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1943.0 L-2893.5 L-3655.3 S-0167.4 S-3110.3
S-6153.3 S-9146.7 S-1285.8 S-15154.7 S-24123.4
C-056.4 C-298.7 C-443.5 C-639.0 C-850.1
C-1039.1 C-1298.7 C-1484.3 C-1658.8 C-1865.4