Summary
Transcript IDgene_000027829
Gene IDTTHERM_00490580
Length514 bp
Sequence
GTAGTTTAGTTTTAAGCAAAGTTGTATAAAATAGATTTATTCATTTATAATTTAGCTTAAGTAGTTAAAATAGGCAAGGAGACATTTTAGGTGTTTAATTTAGTAAGCTTGAGAAAGTATGAATCCTAATTATCAAATGAATTAACAGAGAAACTAGTAATAATAACAATAACAATAGTAGTAGATAGAGAATTATTCTCAGGATGGAGGAAGTTTGTATAGTGAATAGTAGGAAAATGGGGATTAATCAGAGGAGTAAGGGTAATAAGATTAAGGAAATTTTGTCTAATAAAATGTAGCTCCACCTCCTTTGACAGAACAATAATTAAAAGAAGAAATAAGCTTATTTTTTAATATATTCGTAAATCCGCCACTTATTTTTGGTTGTCTGACAGCAATAGCATTTGAAAATAACCAGATAATTTACTAAAATTAGAACATTTAACAAGCATTTACTTATTCTTCGCTATTATTTTACTCTGTTATGTCTTTATGCTATTGTTTTCAGTTCTTC