Summary
Transcript IDgene_000027861
Gene IDTTHERM_01082940
Length1466 bp
Sequence
ATTTTTTGATAACATAAAATAATAAAAACAAATATACACTCTTTATTTTTAATACATTCACTTTTCATTCATCTTCTATATCCATATATTAGTAATCATCATCATCATATCCTTCATAAGTATTATAGCCATCGTTATTTTCATATTCATCATATCCATTTTATTCATTTATGGGTACTTTTGCCAATTATTTGAAGTCAATTTTTAGCTTTTGGCTATCTTGCAATATGGATTATTTTTTAATTAAAGTTTTGTATTCTTCAGGATCTTCTTGATATAGGGTTTTTGCATAGTGATTATAAACATCATCTAAATTCTTTTCATAAAGTAAACTGACTATACTTACAAGCACTTTTTAAATGGTAAGCACTGTACTCCATTTATCTTAGAGAATATTTAGACATATTTCTCCTTATTCACTGATGTTTGGATGCAGAATTTACTAGTTGAAAGTAACTTTGGGAGGCTCAATAGGGTATTAATCAGGTATTTAAATAGTAACAGTGTAGGGTATTCCTTCGTAAGGAGTGTCTTGTGGACCTATGATCAAGCCTTCAAGCTAATTTAAATTATCTGACTAAGTGTAGTAAGCGAAACAGTGATCACTGCAATTAGAATAGTTAAATTCAAATTTATCATCTAAACACTCAAACAATTCATTTAAATCTCTTCTAAGTCTTAAATTTTAGATTTGAGGGAATACCTTTATTTACCTTTTTGCTTACAAGCCTATTTTGTATAAGATCTTTTATTAACTCTCAAACTTGTTAGAAATAAAAACCTCCAGAGGTATCTCATTAGAATTAAATTCTTAATGTTTTTAGTCAAAATTCTTATAGTCAATTTTAGGCTTAATAACTAAAAGTATAGTGAAACCTATTGAGTCATAAAATAATTCCGCTATATCATTTCTTTTAGCTACACACTTTTATAGTATTTCAGGTTAACAGAAAATGCTAAAGAGGATAGCTTATGATCCATCAGGTTTGAAATGAAAGGAAATATCTGGTAATGATAAATCAGAGGTAGGGTATTATGTCACAAAATTTTGCATAAAATCATGACTGGCTTCGTTTTATTGTTGAACATCTTTTAAATTAGAAAATTGACCTATCCAATCTTTAATCATTTATAAATCATTATCTATATTATGATTTACTTCAAATTTAAATGGTTAGTCATATAAGGGATTATTTTGGTTATTTTAATCATTTTAATTTTGTTAGATTTCATATTATTGGTTATTTTAAACATATTAATTTTGGTCATTTTCATCTTGTTATACTTATGAACTTTTTAATTTTTCATATTATTAATAATTTTAGGAATATGAATTAGATTAATTTTCTTTAGATTCCTCTATTTCATCTCTGTTTATTTCTCCCTACATTTTATTAAATCTAGAGCAAAAAGGGCAATTACATTTTCCTTTATATTATTATTATTGACTCATTTTTTTATGATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1450.4 L-2259.9 L-3962.4 S-0127.3 S-3455.5
S-61,487.8 S-9981.4 S-12472.8 S-15240.7 S-24361.8
C-0597.6 C-2266.5 C-4370.3 C-6144.7 C-8604.6
C-10353.1 C-12301.2 C-14551.7 C-161,107.4 C-18641.7