Summary
Transcript IDgene_000027920
Gene IDTTHERM_00394700
Length2107 bp
Sequence
CTTCCATGAATACTTACTGATATATAATTTATGTAAAGCTTTTATAAATACACTAATAAAATTTAAGTTGATACTTAACAAAAGAGAAAGGAAGGAAGGAAAATTTCAGTAGAAATTAATTTAATATAATGTAAATTTATTTTATATTTAGTTAATTAGTTAGTTAGATGGTAAATTTAATTATTAAATTATAGGAAAAATATTTATTAAATTGTTATCAAAAATACTTAATGATTTTTTCATTTAAAAGGAGAAGGATTATTGAGTTATTCACATAGTAAGCTCCTATTACTTCTGAATCTTCAGAATCTTTAACTTAAAGTTATATTGGTCTCCTTATGAAGGAAAAATTCTTGAAATCAAATATTTAAAAGGTGTTTTCCTTCTCTGTGTTTTACATTATGCAATACCTTTTGTCATAAACTTTCATATTTTACAAGCAAGACATAAATTCTAGGCATTCTTCGTTTAATTTTTACCCATTTTTATATATTTCTATAAATTCTTCTCCTAACTAAACCAAAATGGTGTCTTCATTTATTATTTTTATGCATGTTATGCTCTCAAGTTCTTAATCTGATAGTATTTCTTTTCTGTAAATGTATTTTTATCTCAGTTCTGGATTGTTTTTATTAAACAAAAATTCTTTTACAGAACCACTTTCACAGCAAGTTATCAGTCTCCCTTCACAATAATCCATAATGCTTATTTTTTTTGAGTGTATTTTATTACTTTCTAGTATCATTTGCTATCTTTTCATATCCCAAACCGATATTTTACCAAGCTGATGTCCTATGAAAATAATTTGTTCTTCTTTATCACATTCAATGCAATCGATGTTAAACTTAAAATCTATTTGCTAAAACTTGCTTTCATCAAATATACTTTAAACTTAAAAGAATTTATTGTTTGGACTGAAAATAACCACTTCTGAATCACTAATCTGCTTAAATTGAATTAATTCATTGTCATTGGTAAAATGAATAACTCTTTCTAATCTCATTTTTTACAAGTTAAATACTTACAAAGCTTGTCTTTTGCATCTCGTTAATAAATAGTACTATTTTTATGCCTTTGATTTTTAAATTAAATTGCTTTCAAAATCTCTCATTATAGGCTAATTATTATTCATATCTTGACTTTATGAAGTCTCAAATAAGCAAAAGTCTTCAATATACTCACTAGTTATCTAAATCTTCTAAGTTTACTTGAATTTAAAGTCTCCTAAAGACATATACCTGCACTAAGTTTCTACTTGGGTCAGTTTTGGTGCAATCTTATCAGAGACAAATGAAGAAGATTGATTAAAAGATGAAATTATCTAAGAAGAGGAAGATTCCATTTCTGAGTTTCTAATCTATTCATTTTAAGTAGGTCTTCTACTACTACTATTTAGTAATACTTTCTTTCTTACACTGTTATTTGAAGCAACAGATATCGAAGATGCATCTAAATTTTATGAAATTTAAGACTAATCTAAAATAGAAATATCACTTTTTGACTGACTTTAGCTTGCTAATTTACTCTTTGAATTGTTAAGATAATATTCGTCTTCCAATAACTCTTAATTTTCTTCTAATTAAAAAAAGACATCACTCAGTTGTTAATTTTTTTATTGTCCATTCAAATAAGTGACATCTTTAAGGAGTTCGATGTAATGAGATGCCTTTTCAAAAGCTTACTCATCACCGAGTTAAATCTACTTGAGTATCAAATCTTTTATTTTTATCAAGTAAGTATTGACTTCCTTCATAAAAATATTCATTTAATTATCGAATTCAGAAATTATACACTTTCTTTTCGAGTGTTAGCTATTTTGTTCATAATTTTCTTAGGTAATTAATTCACAATTTTCATGTATTTAACCTTAAAGAAAGCATTTAGAGCATCCCCTTTAATTAAAAAACTTGCATTTATCATTAAGACACTATAGTTCTATTATCCTTTTGTGTATCTTGCAAAGCTCATTGTTGTCACTGTTTTAAATATTTAAGCTTTGAGTATTACTTAGCTTCATTCTAATCTACACTTATATATCTATCTATCTTTTGCTATTTTGTACTACAAAAATTAATGATTATTATTAATAATTTTTGCTTAGTAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1175.1 L-2117.6 L-3132.1 S-059.1 S-396.5
S-653.2 S-946.6 S-1258.6 S-1569.6 S-2479.1
C-034.0 C-23,894.6 C-41,386.9 C-62,344.1 C-8532.3
C-10430.5 C-12581.3 C-14428.1 C-16289.8 C-1891.5