Summary
Transcript IDgene_000027922
Gene IDTTHERM_00394650
Length747 bp
Sequence
AGGAAAGTGTTAATGAATTCTTAGTGAAATTCAAAGAACAAATAGGATAAATGGTAAACTCTGATAATCCCAAACAAGATATTACCATAGTCAAAATATCTTTTGATCAATAGCCTTAGGTAGACTTTTAAGTTGTTTCTAAGTAGTTTAATCATCAGGAAATCAAAAAGAAAATATCCTTATAAGATATAGGAATGTCTTTCAGTGAAAAAAGTCTTTTAGAGGGCGCGAAACTATCTGTTGATATGTTTGACCCATAATTCAACATGGAATGGGGGAAAAATTTCTAAGGATAGAGTACAAAGAGAGGATAATTGACACTGTTTGACTAAGTAAATCCAGTTGACCACCTCTACTACTTCCCTGTTGGTTATAAAGGCTATGCATTAAATATTGACAGATACGGATATGACAAATCCTGGATTTCTTCTAACTCAGACTCTAAAACATGGATAGTCTTATACCATGGGACAAAAGAAAAAGCTGTTGAGAATATAACAAAAAATAACTTAATCGCTGGATAAAATAATGCATATGGAGGTACAACCTGTAGGATAACAAACACTAAAATAAAATAGGGTCCAAATGCTAATATATATTTAACTGATGATTTAGCTGTAGCTGAGGAATATGCCGTAGCTACATCTGCTCATGATGGAAAAAAATATCATGTAATATTTTAGTGTAGAGTAAATCCATAAGGAGTTAAAAGTCCAAAGCTAAAACCAAGCTATTACACAGTTGAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-127.4 L-239.1 L-351.1 S-042.7 S-382.3
S-6131.9 S-9114.5 S-1291.9 S-1566.9 S-2433.3
C-0137.2 C-265.0 C-488.4 C-654.2 C-8111.9
C-10460.8 C-12607.2 C-14465.3 C-16468.8 C-181,073.3