Summary
Transcript IDgene_000028028
Gene IDTTHERM_00419940
Length558 bp
Sequence
CCCATATATAGGGAAATTTATCAAAAAGTAAGATGACAAATAGTTGAGACTAACATAGGACTTGGTTAAAAGAATAAGACTATATTCTTGAATGTTATGGGTAAAACTATCAAAGAATCCCCTCATTAGTAAGACATTTAGCACAGGATTGAGTGAAAGTAAAATAAAAACAAAAAATGTTATTACTGATATTTTTAAAGAAAATCTCTAGAGACTATTTGTTTATGAGATTGTTCTCTTCTTTTTTTCTGTAATTGGCAGAAATTTCATAGTATTTTAATTTGAAGAGACAGCTTACGAGTTACGACGAACAACGAGCAATTTTTCAACATCATCATGCAAAAATAATTTATTCAGCTATGCTGATCTATACTTAGCTATCTATGTAGCAATTAGTTGTGGATTAAATGTGCATATTAGTTTAAGTATTTCTTCTTTTCTTCCTTAAATAGTATAATATACAGGAAACACAACAAGAACTATAATCGAGCTAATAACCTCAACCAAAACTACACTAAAAATCAAAAGTGATTTTGTTTATGAAAGAATAGTATTTGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1647.1 L-2471.9 L-3831.1 S-0700.7 S-3723.7
S-6585.2 S-9754.9 S-12675.0 S-15689.9 S-24673.3
C-01,364.8 C-21,207.8 C-4663.4 C-6657.4 C-8817.9
C-10694.8 C-12736.9 C-14857.2 C-161,038.4 C-181,165.2