Summary
Transcript IDgene_000028029
Gene IDTTHERM_00419940
Length394 bp
Sequence
GCTAGTTTTAATAATCAGGAGTGCAAAAGAAATGGTAAAATGATTCAAATGTATCATAAATCAAACTTTATACGATGTATTTTCCTTGGAGAGATGTTAAATCCTTAAGGACAGATTCTCTCAACTCAAATACCTATGTAAAGGCTTTGGCAGGTGCCTTTGCTATTTACATAAGGTAGTAAACATAAATTGCTCTAATTTATATTGCCCCTGAATTTAAATACTCTTTATTAAGCTTTCTATTTCCTCTAATTAAAGCATTGATGCTGCTCATTTTCTTTACTGAGGTTGTTGTCCCAACATTCGTATGACTCCCGCCATTTATGTATTGAAGAGAAGTTTCCTTCTAATATTGCTAGTAATTAAATTTGAATGCAGAATTATTACTTAAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1136.7 L-2108.1 L-3112.0 S-0133.8 S-3173.3
S-675.8 S-9143.8 S-12195.8 S-15136.1 S-24134.6
C-0296.5 C-2287.5 C-4212.2 C-6154.1 C-899.3
C-10136.6 C-12207.1 C-141,196.3 C-16179.9 C-18183.9