Summary
Transcript IDgene_000028185
Gene IDTTHERM_00554630
Length1096 bp
Sequence
CCTTCTTTTCTGAACTTCCTAACCTAATATTTGTAAGTATATGCAACTTATGCTTTTTTTTTCCTTTACCTTATGCTTTAAAATGGTTATCTTACTTTAATTATAGTGTCTTCTATATTTTTCTTAAAACGAAAATTGCATAGACAACATTACTTTGGCATATTTCTTAATTTGCTTAGCTTATTTTTAATAAGTAGTATTGATACTTATCAAATTTATTATTGTGACTAAGCAGATTAATCTTTTTCGCAGTGGAGTGTCTTTCCTTATTTAGCTTATATAATTTCCTGGTTTACAAATGCTGCTCAGCTGAGTTATGAAGAAATGTTGTACAGAAAATACATGTTGAATCCAGCCTAAGTTTCTGGGTATGAGGGAATGTTTGGAATAATTTTTGCGCTTATTGGATGTTTAATTGGCACTTATTTTTAAAATGATTATATTTAAGAAGATTTTTATTAATTTGTGAGTTAAGTCTTCTCATTCAAAAACCCTGCTATATTCTTTTTAGTTTTGGTAGTAGTTTTAATAAATATTTTTTCAAGCTGTGTTAATTAGATCATCATAAAATAGATGTCTGCACTAACCAGAGCCATTTCAGACTCTAATTCTTTTATTTTAGGATGGTTACTCTTTATGATGGCTGGTTATTATTCATTTGGATGGTAATATCTATTAGGTTATGTCATTTCTATATTAGGTATAATCATATTTTGTGAAATCTTAGTTCTACCATGGTTTGGATTCAATAAGAATCGAGGACATGATTTTGTAGCTCCTAAATTAAATTATTATTATTCTCAAGAAGCATATCCTTATTACTATTAAGCAAACATTCCCATTCAATAATAATAAAATTATAATGGATATAATAACTAAGTGATTAATTTGGAAAATAACCAATAAAATCAATTCTTAAATCAACCTTTATTAGCAGAGATAAATTTAGCACCTAACCAATAGTTATAAAGACCTTCAAATATTTCTAACTAAGATTATTATAGCCAAAATAGACAATAAACCCTACATTAAAATCTAATTGATTAGCCAAATAACTTTAGTTAAAATTAGTTGAATTTTTAAACCACAAAGGAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1603.6 L-2852.4 L-31,820.4 S-0210.1 S-3382.4
S-6637.8 S-9532.8 S-12447.1 S-15344.8 S-24197.7
C-0602.4 C-2563.8 C-4474.3 C-6749.1 C-81,242.3
C-10768.6 C-121,446.8 C-142,221.4 C-161,993.5 C-183,205.9