Summary
Transcript IDgene_000028186
Gene IDTTHERM_00554630
Length1330 bp
Sequence
GGAAATATTATCTATGTAATTTGAAAATTTGACATAAATTAAATAAATAATTGTATTAATTCAGGATATTCAAGCCAAAACTCCTTAATAAGACCATAGCACCAAAAATGAAATAGCTAAAATTTTGAAAAAAATTGCAAGTTAATTGACAAATGACTACTTAAATACCATAAAAATGAGAATGTTAAAATTGGTCTAAGAAGATTAGTATGCGAATGTTTATAAAATAAATGAAATGAGATATATTTCAGAAAGATTATCTTTCTTAGTTGATAATAATAATAGTAATATAACAATAAAATCCATAAACGAAATAATAGCATGGATTGAGGATAATCATTAGCCCACTGAATTTACACAAACTCTCTAAAACATTTAAGCAATAAACTAGCTATTTTTGAGTGAATACTAGAGAAATTAGGAATCTGGATTGAATTGGAAAGATTAATATGAAGCAATCTAATAAAAATTGAAATTTAATAATAGTCAAGGATAGTAATTTGAACAGTCAAATATTTCTAACTCAAATACTTTAAACCAAAGCGGACAACAAAAATTAGATTAAAATTTAATGAATTAACCTTACTAGCTTAATTAAAATGAACAATATTTAAATACAACAAAAGAAGTATTAAAAGAAATTTTATCGACAGAATTTGAAAACTTGACATAAGTTAAACAAATCATTGTTTTAATTGATTATATCAATTCAAAAATTAATTAAAATGATCATAGTCACAAATCAGAAATAGGCAAAATATCTCATAAAATTGCTTCTGTGTTGATAAAAAACTATTCAAATATCATCAAAATAAAAATTGTAAAATTAATTTTGGAAGATTAATTTATGAATATTTCTAAAATAAATGAAATGAGGTATATTTAAGACAGACTATATTTCCTAGTTATCAACAGTAATATTAATACTAAATGTCTTAACGAAATTATCATCTGGATTGAGAACAATCTTTAACCTAATGGATTAACATAAGTAACTGAAAATTTGTAACAAATTAATGAATAATTTTTAAATGAATAAAAGAGAGATTTTTAGTAATCTGTCTCAAATTGGAATGAATAATACCAAGCAATATTGTAAAAACTTAATTCTAGCTGATATAAGTACATTAAAGCATTGAATAAAAGAGACAAATCAAGAAATAACAGCCTAATGAAGATCAGAAGAAGTTGATAGAAATATGATTCAACTAGAACATCTTCTATTTTTCCTTAAAATTTTATTTGTATTCTTAATTTAAAGAGAAATAAACTAACTAACTAACTATAAGTATTTTTTGTGTAATTTTATTTTTTTAATTTTAAATGTAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1173.0 L-2317.6 L-3831.9 S-0108.0 S-3115.0
S-6233.2 S-9129.6 S-12116.4 S-1583.2 S-2462.7
C-0131.5 C-2168.8 C-4142.6 C-6239.3 C-8371.5
C-10269.6 C-12272.7 C-14713.0 C-16710.6 C-18867.8