Summary
Transcript IDgene_000028472
Gene IDTTHERM_00697140
Length432 bp
Sequence
CTAAAATCTAAAAAAAACTGGTATTCTTTGCTTATGTAATTTTCGTCTATTTTTTTTGATGCTTATTTTTGTTTTATTAATTCTTCTTTTTGATTTATTTTTTATGTATACTCTTCAATTATTTATACTTCAGGTTTTAAGATATCAAAATAGTTGCTAGCATAAAGAGCAAAAGGAGTTCCTATTAAAAACGCTCCTCTGAATGTATATTTAAATAATACACCTACACCTGCTGCAACAGTCCCTAGAGCAGTTCCATTTAGATATTTTTTCTTCATGTCGAATCTTTTAAGTACCTTGTCCCTCTCTTTCTAAAGGTCAGTCAACTATTTACAATAATCAGTGATCATGGCTTCATAGTCCCTTTACTCAAGTTCACTCATTTTTTCTGACCATGTTTTTACTTGTTAATCATCAATAGATGAATTTTCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1703.6 L-2660.0 L-3466.6 S-0335.1 S-3319.9
S-6401.1 S-9383.7 S-12301.1 S-15474.4 S-24434.3
C-0337.8 C-2275.5 C-4222.4 C-6265.1 C-8181.0
C-10192.7 C-12212.2 C-14239.8 C-16245.8 C-18284.3