Summary
Transcript IDgene_000028512
Gene IDTTHERM_00408780
Length341 bp
Sequence
ATTTATTTATGATAGTAAATGAATTAGCATTAGACTTCTAAATTAATTGAGTGATAGGATTTTAGTGTTCTAATATTTGTTGATACTTCTGCTAAAATTTTTATAACTTTTCAATTAAGGGGCTATTGATTTAACCTGTAACTTAGCCAGCTTAAGGTGCTAAATTTTGGTTATTTCTAATCATCTAGTATGTTTGGTTGTTAGTTTGTTTTGGTTAACTTATATGTGTCTCTAGCTTTCGAATAATATTATGCGCTAACTCTATATTTATATTGATTTATTATTATGCTTCTTTACCTCTAAATCAATAATAAATTATTAATTTTTTTATTATCAATTTC