Summary
Transcript IDgene_000028626
Gene IDTTHERM_00688790
Length1073 bp
Sequence
AGCAAAACTAAGAAAAACTGGTAATATTTATGTGCTCAGGAACAGAAGTTTTTATTTAGTCAGGAATCATAAGTGATTATCATGGCTTAAACTTAACAGGCAGTCCTGCTTCAGTTCATACATTCTCAACATACTTAAAAGCCCATAATATTCCTTTAAATACTTTTACTTCAATTCCAGCTATCAATCTTAAGACTTATAATAAACCTAGAGTAATTCTAGCTCGTGATCCAAACGCTTCAACCTAATTTGTAACTATGGTGTCTAATGAACATTTTCACTTGAATGAGAAATTACCATCCGCAAACGATTTTACTCCACTTAGAACAAAAGATGGTTACCCAGCAGGAAAATTTTATCTTAAAGGGTTATTTGAAATGATTCCAGAAAATACTATCCTATCCTCGCTTCCTATTGCAAATTCGATTAAACACTTAATGAGTTAAAATCGTTTCTTAAGATCTGAATATTAAGAGATGTTAGCTGATAGCCAAAAGATCTCATTGATTGCTATGTCAAGTGGTGTAGTTTAAAGAGAAATTGATTAACTATTTGAAAAGTTAAAATTTTCTCCAAACTTAAGTTATACAATTTGTCCAGGTTGGGTAAAGTAGTATAAAAACTCCTAAATATTTACTTTTAGCTACCCACCAACACAACCTTTAAAGAAAATTATTTGTGATTATTCTTATGAAGAAATTTTAGAGAAAAAAATTCCTTTCGATAATATCATCATTCCAGGTGGTCTTTTCTCTACAAACGCTGTTCTTAGAAATGATGATGGATTTTTAGATTTCTTGAATTAAGCCATTAAACAGAAATCAAAGCAAATACTATTTTCCTCCTCTGGCTTAGATCTCTTACTTCCTTTGAAACTTAAATATCCAGATAATTAATTGATTTAAAGAATTAATGAAGTTCCTGAAGACAGAGATGTAGGAGTTGATACCAAACTAGCTGGGTTAAATAATAGGAGGGATAAAAAAATAATTTCTTTAGAGTAAATTACTTTATCCACTTTTAATTGAGTAGCAAAATATATATATTATCATTAAAATTATACTGTAGCCTGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-114,772.0 L-212,770.3 L-315,343.8 S-04,520.4 S-3322.0
S-6154.2 S-9155.8 S-12206.3 S-15224.9 S-24131.0
C-0338.2 C-2114.7 C-4133.5 C-6141.9 C-8765.9
C-101,568.5 C-12670.4 C-14227.6 C-16171.6 C-18242.1