Summary
Transcript IDgene_000028632
Gene IDTTHERM_00689850
Length870 bp
Sequence
GTGATAATCAAGAAATAATCCATCAAAAGAGCAACAGAAATGCAGACATACATGCATAAAGATTAAAATCAACAACGAGATAATAAAATTTTTAAAATATATAAGTTTTAATTCATATTTTTTAATATTGCTACTATTTTGATGCTATTTCTTGTATTTATTTAATGGATGGCTTTATATATAATGTTTTTAATTGCAAATATGTTTACTATTTATTTTTCATTCATTAATTCATCTTTTCATTCATTATTTTGTATATACTATCATTAATTATTTTTATTATTCAAACAAAATTTTTCTTTGTCATAATATTGTAGAAATCATCTTCTGTTACCAATCCATCACCATTTGAATCAGCTCTTTCAATCATTTCTTATAATTCAGAATCATCCATTTATTCACCTAATTCTTGGGCAATTCTACGAAGTTACTTAATTGAGATACCAACATTGTTTTCGTCATTGAAAAGCATGAAAACTTTTCTGATATCTTCTCTTGAGTCCTTATCAGAGATACGAGCGGTCATCAAATTTAAGAATTCAGCGAAATTGATTTAACCACTTTGATCAGTATCAAGATCTGCAATCATTTTATAAATTGTTTAATTTTTTGCTTCGAAACCCAATGATCTCATAGCAGCTTGAAGTTCAGAAGGATCAATTGTGCCACCAAGATCCATATCGAAAAGATCAAAGGCTTCCTTAATTTCGATGACTTCGTCTTCAGTAACACCTGGTCTAACATAATCTGCAGGATTAAATTTCTTTTGTTAGGTTTAATTCTTTCTTTGATTCATTTTCGTTAGATTTTATTCACTAGTTTACCTTTTTATTTATATATTTTTTTGAAGATATTAATTTTTTTTATTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-17,865.2 L-28,060.2 L-36,195.7 S-02,819.4 S-35,238.3
S-64,834.4 S-96,372.3 S-126,614.5 S-156,864.7 S-246,256.3
C-02,336.6 C-21,378.3 C-41,237.2 C-61,556.9 C-84,152.0
C-102,979.9 C-129,430.9 C-146,711.7 C-164,598.1 C-183,898.3