Summary
Transcript IDgene_000028650
Gene IDTTHERM_01289180
Length954 bp
Sequence
TGATAACATAAAAAATAAAGAATAAACGTTTTAAAATTTAATGGTTTTATTAAAATGCTATATCAAATTTTTTTATTCAAAAAAGATTTCATTAGAAAGCCTTATCAATTTATTCTTCAGTTGTAATTTCGTCTCCTAGCTTTTCAATTACATAAGTAAACTATCTATCTACTTCAATAAGTTTTTCAGCAAATTCTATATCTTAGTCTTTGTATTTTTAGGTTACTTTTCCTAAGATATCAGTAGGGGAATCAGGCTCAAGATTAACTCCTTCATCTAAAATTAATTTATTCTTTCTATCTCTCATATTTAACTAGCCTATTTTTCTTAAAAATTTAGGGTTTTTTAGATTGATTTGTTTTTCTCCTTCTTTCTTTAAGTCAGTGAATACTTTCAAGTATAACTTAGTTGATAATTTCATTATTTTTTTTACAATGTCATAAGTTTTGTCTTTTGTTAGAATTTCAAACACTTCTGGTTTTACATTCATTGGAGGTTCGATGCCTTTTAAACTATTTTCGAAACCTTCATGAATTTCATTTAATATTTTGTTTATTTCATCATCATTTTTGAAATCAGATTCTAAGGCTTAAGCTAAATCTTGCTCATCAATTTGATACTTGATTAAGATTGCTTCCTTTTTTTGATCAAAAATTTCTTAAACTTCACTTCTAATATATCCTGCTGCTGTGTTTTCTACTTCATTTTTATACTAACCCCCAGTTTCACTTATCATTCTTTAAATAACTTTGGCAGTAGTTATGAACTAGCTTTAAGATTATGACTTTAAATCTTTTAAGAACAAAACCACTTAATCTCTTGAAAGTTTTACACGGACTTTATTTTTACCAAAAAGCATATAAAGTCCTCCTAAAATGCCTAATCCTATTGAGCCTAATATCAAAAACTTAGATCCTTTTTCCATTTTAAAATTATAATTTTGAAATATTTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,328.0 L-21,278.9 L-3879.4 S-0111.6 S-337.0
S-638.0 S-946.9 S-1238.6 S-1541.6 S-2442.8
C-054.9 C-251.8 C-455.6 C-641.0 C-848.6
C-1084.3 C-1262.4 C-1454.6 C-1646.0 C-1833.9