Summary
Transcript IDgene_000028739
Gene IDTTHERM_01125120
Length1223 bp
Sequence
AATAAATAAATTACAAATAAACAAAATAAATAACAAATGAATAAGAAAATTCTTTCATTATTGGTTGCTTTAACCTTATTACAAGTCGCATTAAGTGCTGATTGTGACTTTTGTAAATTTAGTGCTGATGGTACTGATAGTGCTGGTGCTTGTACTGATTGTGATCCAAATACTTGCACTAAGCAAACAAAAGCTGCTGGTGCTAAGGAGGATGTTTGTACTGCTTTACCTTGTCCTTAAGGTACTTACAGTGCTATAGGGTTTGATAATGATGGTAAAGGAGGAAACTGTTCAGCTTGCGATGCTGGTACTAGTACTCCTGCAGCTTAAACTAAGGGAACTGATAAATCAGTTTGTACTTTAAAGGCTTGTGTTCAAGGTACTTTTAGCTCTACAGGTTTCGATAATGATGGTAAAGGAGGAAACTGTTCAGCTTGCGATGCTGGTACTAGTACTCCTGCAGCTTAAACTAAGGGATCTGATAAAACAGTTTGTACTTTAAAGGCTTGCTCTCAAGGTACTTATAGCTCTACAGGTTTCGATAATGATGGTAAAGGAGGAAACTGTGCAGCTTGCGATGTTGGTACTACTACTTCTGCAGCTTAAACTTAGGGATCTGATAAATCAGCTTGTACTTTAAAGGCTTGTGTTCAAGGTACTTTTAGCTCTACAGGTTTCGATAATGATGGTAAAGGAGGAGACTGTACACCTTGTGATGAAGGTACTAGCACCGCTAGCAATTAAACTTAGGGAACTGATAAAGCTACAGTGTGCACTCTCGTTTTGAAGTAATGTGTTGCTGGTACTAGCAGCGCAACAGGTTATGACACTGACGGAAAAGGAAATGGTTGTAATCAATGCGGAGCTAATACTTACTCAGCAGCTGGAGCTAAAAATTGTACTCCTTGCGCTAATAGTCGTGTTGCACCTGTTGGTTCCACTGTAGTAACTGCTTGTGCTTGTCCTGAAGGAACTACTGGTCCTGAAGATGGCACAAGCGTATGTGAAACAAGCACTAATTCTAACTCTAAGCTTATTCAATTTGTCTTAAGCTTCATCTGTTTGGTTCTTCTTTTCTGATATTGATTAAATAAAATATGGCAAAAAAAATTTTTATTATTTGAAATGGATACTATTTATTATACTGTAATATTTATTTTTATAAAAAGTATTCGTTGGAAATAATTAAAAATTTTATCAACAGATTATTAATTTTTCAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-158,921.3 L-251,984.6 L-357,173.8 S-06,763.3 S-3490.1
S-6234.8 S-9227.2 S-12245.7 S-15414.7 S-241,286.5
C-0237.7 C-2915.8 C-4344.7 C-6238.8 C-81,166.4
C-10925.0 C-12411.3 C-1498.3 C-16128.9 C-18294.1