Summary
Transcript IDgene_000028795
Gene IDTTHERM_00300080
Length505 bp
Sequence
ACTTGCTTAACTTTAATTTTATTATTTATTTAGTTTTTACTATACTCTAATATTTCATATTTTTCTCTATTAATTTATTTATTAATTATGATATGATAGAAATATCCGTCTCTATTTATCTTACAAGTCTAATTTATTTCAAAAATTATTTGGGTTAGCACCAGCTAAGAATTTTATAGCTAAAGCTTCTAAATCTTATAATGTAACTCTTCCATCATTATTAAAATCCATAACATTAAAAAATGTATCAGTGTCTGCTTTTGTTGGATTAAATCCTTTTCCCATATCTTTATAAGCATCTTACATCATACCTGTTATTTCTGAAGAGGTAATTTCACCACTTCCATTTTTGTCATACTATTCAAATAATCTTCTTGCTACTAATCTAGCTCCTTCAATATCTGTAATTCCTCCTATTGGTACTCTATTAATAGTTGAGTTTTCTAAATCTTAATTTTCCTAGTTTGACTACATTTTAATAATCTTTAAATTTTGAACTTTTCTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1579.7 L-2423.3 L-3311.8 S-0504.4 S-3303.7
S-6369.3 S-9225.7 S-12136.5 S-15206.5 S-24212.3
C-0221.2 C-2157.2 C-4116.3 C-6191.4 C-8122.1
C-10207.5 C-12280.5 C-14202.4 C-16175.3 C-18150.5