Summary
Transcript IDgene_000028873
Gene IDTTHERM_00633390
Length546 bp
Sequence
TAAATCTAGTTTTAAATATGATGAATAAATTAAATAAAATCTTCCTCCTAAAATTATGGATATTGAATAGAAGCTAGAGAAATTTAGATAACAAAAGTTGAAGAGTGAAATTCTTGCAAAAACTTTAAAGGACTAAGAATTAGAAAGGGAAAATTAATGGAGAATTGAACATAGACAATTTGAAATAAACAAAACTCGTAACAATCACAAATATATTGAAGATAAAACTAAAAGCATTTATGAAAATTGGCTTAAAACTCAATAAGTTATGCAAACCAGAATTAATAAAGAATAAACTCTTAATAATTACCTCACTAACAGATTAAAGGAAGAAGTAAAAGCTGTTGAAAATTACGAGTTTAAAGAGTATAAGGAGGGATTAGATTATTTTAAGGAAAATTGTATTCAGTAAGGTGTTTCTTTGAGACATGATCCTGATAATTATAAACCTCCTCCTATTTCTCACTTTAATCTGAATGCCACTATGATGAGAATCAGAGAAAGCACTCACAAATCTATTTTGGCTAGAAAGGATAAAGAAAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,933.7 L-22,197.7 L-32,202.2 S-01,304.3 S-31,147.8
S-6892.4 S-9960.7 S-12931.0 S-15761.5 S-24855.2
C-01,122.0 C-2732.4 C-4592.8 C-6648.3 C-8909.9
C-101,470.0 C-121,682.8 C-141,878.6 C-161,515.7 C-181,276.1