Summary
Transcript IDgene_000028882
Gene IDTTHERM_00635810
Length743 bp
Sequence
TCTTAATCATTTTTTTACTCATCTGAAAACAAAAAAATTTTATGTGTTAATTAATTAATTAATCAATCAATCAACCAATTTATTTGTTTGTTTGTTTTTGTTTAATTAATTCCTTTTGTAAATTTAAAATATCTTTTTGGCTAGTTTCTCAAATTCCCTTTTTTAGGATTTCTTGATACTTGCTAACAGTCTCATCTAGCTTTGAATGGAACTTTTTAGTTAGTTAATGATCATCTATATTTTGGTTAAAGGGATTTAAAATATCTTATCTATAGAACTAATAAATTTCATTCATCAAATTTTTGATATGTCTTTCATCATAGTTTGCCATATTGCTTTTTTGACGCAAAATGACTAAAATCTTCAACTATCCAACTGTATAATAACCATAAATATCAAATTCATCTTCAGCAAGATAAACTGAATTTAAACAACCTAAAAATGAGCTAATCTATGATTTATTTTCTGTGACTAAAATCTTTTTGGTAATTTGATTATCAATCATATCTAATGTGGCAAATATATTCATTTAAAAGTTTAATTCTTCTTGCTTTGAATGGTTGTAGTTTTTCATTAAAATTGGCTCGTTCTTATTGTTTATTATCGAAACATAAACAATAGAATTTTTCAATTTCTCGTTCATCTTTCACTAATTTCTGACTTTTATATATATATTCCCTAAATTCTAATTTATATTTTAGCTTTATTTCCTTCTTGAATAAAATTTCTTTTTCAAACTATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1738.9 L-2745.7 L-3677.0 S-0928.1 S-3661.5
S-6874.3 S-9666.3 S-12454.2 S-15555.0 S-24497.5
C-0269.9 C-2292.7 C-4617.0 C-6493.1 C-8245.3
C-10404.6 C-12570.4 C-14646.8 C-16506.2 C-18406.3