Summary
Transcript IDgene_000029268
Gene IDTTHERM_00285420
Length865 bp
Sequence
CTTCCTTCCAAAAATAAAATAAACTATTTACAAATAAATATGCATTGATTTTTCCAATAAAATATGTACAAAATAAAAATTTGTCAAAATAAATCTACTTAATTTACTGAATCATTAAAAGTATTGAAATTGGTTCATTATAAAAAACATAAATCAGGTAATTGAATGGATCAAGTGAACCTAAAAAATGCATAATATAGAAACCTTTTTATGAAGTACTATAGAGTTAAATATTCGCCATTTAAATCTCCTAATTGTCAGAACATCACAGAATATTATTACAGTAAATTTATTAAATTTAATTGGAGCAGGACTGTTAGAAACTTAGTTCTATTGATATATTTATTTAAGATCAATTAAATTTGTTAAAATTCTAGATTTATTTTAATTATTTAATTCAATTTAGAGTATTCTCAAAAGTTGTAAGTGCGCTATAAACCATGCTAACAATATATATTATTTGCTCTTTGAATGGTATTATTGAACTTATACAGCAATTTTAAATAAAATCTAATTCTTTTTATATGTATGTGAGCATCTCTCTATCCTCACAAAGAAACTTTTAAATATCCTGTTCTATAAGCACTAGTAGCTCTCTTATTTTACGGTTAAGAATGGTATCTTTCTCTATGCTATAAATATAATTCTTATTTTATTAGCCAGCAAGGAACTCTTAGTCGGATATGAGCTTTTAGTTAACTTACTCTAAAAACAAAAATATTTATACAACATCATTGATTACACTTTTATTTGTTATATGAAGAGAAACAAATTCTAGAAAATCACACAATTAATCAGTAGTTTTAGCCTTCATCCAGCTTTCTTTTTACCCCTCAGCAAATTTATAGCTTTCTTCCATATTTTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-129.4 L-231.7 L-324.7 S-037.1 S-331.8
S-634.2 S-929.9 S-1231.9 S-1532.0 S-2438.5
C-038.7 C-29,436.8 C-42,643.9 C-6872.4 C-8246.3
C-10167.4 C-12596.5 C-14394.8 C-1684.2 C-1862.9