Summary
Transcript IDgene_000029469
Gene IDTTHERM_00584990
Length791 bp
Sequence
GATTGATTTCGTATAAGAATGAAAATAATATTAAAACTATTAACACTTCTGGCTTAAAGAGACAGAGCAATGAACTTAGTGAATAAATGTAAATAGAAATTGATAAAAAATCACAAAAAACAAAACAGCTTGATTAATAAAAAAGCATTTTAACCCCATCTTTTAAAGGACCTGAATCTTTGTTTAATAATGCAGACAATTCAAATAATCCTACTTTTTCTAAAATACAAACAAAAGAACTTCCAAGCCCAATTGACTCTAAAAAAAGTGGTAAAGTACCATCTATTGAAGAATAATAATCGCCAGCAGCTTGTATAAAGTATACTAACACTCTTCAAAATAATTAGCTTAATTCTTCACTTCCTAGTCCTTAAAAGAGTAACGTAATAGTTAACAGCAATTTAATTTACAGTAATATTCCAAATTCTTATCAGTGCATAAATGAAAATCAAAACAATTTTTAAGAACCCTTGTAATCTCCTACTCAACAACATCAGTAAGGCTTTTAATTTGATTAAAAAGGAATTAATTCTAATAACTATATGGAAGTGTGCAAATCAGTAAGAGGTTTTGACTCCAATAGCAATAATGAGTAAATGTTTTATGAAGCGTCCGTGGTATCTAATAATTAATTAATAAATCAAAGTATCTAGCAATAATAATAATAATAATAATTTTCACCCAGAAAATAGCTATCTTTAAATAAGAAACCCACTCATGCTATAATTAATGCTTCTTCTAATAGAAACGACGACGAAGAAGAAAGTGATATTGACATATTTAATAACTAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1444.2 L-2413.5 L-3447.7 S-0350.5 S-3466.3
S-6391.5 S-9464.8 S-12538.0 S-15394.6 S-24675.2
C-0983.6 C-2837.7 C-4495.2 C-6558.9 C-8488.8
C-10498.3 C-12370.3 C-14466.1 C-16522.7 C-18607.4