Summary
Transcript IDgene_000029561
Gene IDTTHERM_00425840
Length1356 bp
Sequence
AAAAAATACAAATTTATTAATAATTAAAAAGGAAATAATGATTAATAATAATATTCTCTATCTTTGTCTTATTTTGATTGTTTCTGGTACTTTTGCTTTCAAGATCGCTCCTGATCAACAATGTGTTGTAAAACCAGAACACTAATAGAAAGGTTTTGGTTGCTTACCTCAATACTCTCACACTGAGCTGGGTCATGCTTACTAAAAAAATTTCAACTCAAGCGTTGCTAATAACACTGATTTCTAGTCTTTAGATTAATTTGCTTTGACATATTTTACTGAGGATAAATGTACTTACTATTAAGATTTATAAGTAAATGTGATTTATAACGATTCTTATGTTAAATAAGTTATGTATGAAAACTTCACTAGTGCTTTTTAAAATAAAACAGTTAACATTGTAAAATACTCTCCATATCCCGATGGTAATTAACCTGATTACTTATTTTACTCTTAATACTTTGATTGCAAAAGTAGCAAAATTATTCTTCCTAAATTATTTGAGGAGAAAGGAGAATCTTACAATGTGTGTCTTTTCAACGAAGTTAAATACTTAAATAACTCAATTGATTGCAATTTAGCTCACCTTTTTCACTACAGCTCTGAGTAGTTGTTTGGTTTCTTCAACACATCATCATTTTAGGATTTCATTTATGACCACGCTGTACATGTTATTAGCAATTTGAAAGAAGTTGATGCTGACTTTTCTCCTTTTGGATCCAAATAATGGTATTTCACTTTCAACTTTATGCTTTAAATGACATTAGATGTCAAGGAATATGAATCTTTAAATCAAACTCTCAAATTCTTTAACACAGCAGTTCCTAAAGCTTAACTAAATAGATAAATTAGACCTTGGTTTGTTGGAATAGCTTCATACTCTCCTTACGAACTTGACTTAAATGGTGGAATTATTTTAAATGAAGCCTTATATGGATCTTTATATGATAACATAAAAAGCAATCAATTTGATATTCTTATTAGCTCTCATCCCGATCTTTAATAGGCTAAGGTATTTATCAGCAAAGATTATAGAAACTTCTCCTAAGTCAATGACACTAATTCATTAACTGCATTAAGCCAATTTGAAGCTTTTGTTTTGATTTACATTCCATCATAATTAGAAACTCCTGCTATCCTCAATACTTCCTTCGATTCCTTAAGAATTAATTTAGAAGGCAAAGAAATAATTAACATTTCAGCTGCTAAACAATAAACTGGGATTTAGAAAGATATCTATTGATAGAAATTTATTATAATTAATTAATAATTGATTAATTTTGATAATAAAAAAAGGTTGAATTTATATTACATATTTTTATTTATCTCTGATAAGTAAGCTTTTCTGGTACAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,879.6 L-22,927.1 L-33,996.4 S-01,517.2 S-34,876.5
S-66,440.0 S-95,231.3 S-124,497.2 S-154,678.4 S-244,374.6
C-06,695.2 C-21,939.9 C-42,381.9 C-61,439.6 C-81,677.9
C-102,369.4 C-122,920.8 C-144,219.3 C-165,968.1 C-189,407.6