Summary
Transcript IDgene_000029759
Gene IDTTHERM_00502620
Length652 bp
Sequence
AAATAATGTTTTTCTGATACCTAAAAGATAATTAGCTTTGAATCAGATTAATGGAACTCAATTCACGTTAATATCAAATAGATTCCATAAGAAAAGCAATTATTTAGTAAAATTTTAAAAAATTCAGAATAGCAATGGCTAAGCGATTAAAAAAAAGCAGTTTGGCTAAAAATTAATGTTGACCAATTAGAAGTATTATAAGAATCTATAAATTTAGGATATAAAATTCATCACGCAACAAGTGAGTATATATTATTAAGTAAATGGCTTTTAGAAGGACAAAAAAATAAACTACCAGGATATGCTAGTCATTATGTAGGATGTGGAGGTGCTGTTATTAACTCTAAAAATGAAGTATTAATGGTTTAGGAGAAATATGGATATAATACTGGTATATGGAGCTTTCCTGGTGGGAGAGCTGATCCTAACGAAGAGATAAACTAAACTGCAGAAAGAGAAGTATATGAAGAACTTGGTATAAAAGTAGAAGCTGTTGATTTGTTACTAGTAAGAGAAAGTACATAATCTATATTTAACAAACCTGATCTATACTTTGCTTTTTTAATGAGACCTGTTGAATAAAATCCTGAAATAAAGTTAGATAAAGAAGAGCTAAATAATTATACTTGGATACCTTTATCCAAAATCGACG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,240.0 L-21,020.7 L-3901.0 S-0207.0 S-3361.7
S-6430.7 S-9394.8 S-12345.0 S-15391.4 S-24488.8
C-0508.9 C-2339.0 C-4654.3 C-6272.4 C-8267.0
C-101,039.8 C-12669.2 C-14407.1 C-16315.4 C-18271.9