Summary
Transcript IDgene_000029769
Gene IDTTHERM_00384780
Length438 bp
Sequence
TATTAATACAAAAAAAGAAAATATTTATTTAGATCACTTGAAATAGTAAATATAGATATGAATTGATAAAAGTATGGATTTAATAATACTTGGAATATCATATATATCGAGTTATTATATGTTGAACAACAAGATTTAATATATTGTAATCAATAATCTCTATTTCTACTTCCTGTATTTTAGTTATTTTAATTGCTATTTACAAAATCAGATACTGCTTAATCTAAAACATTTTGATTTTACTAATATGGTTGCTAGAACTGTTAATTATTTTATTATTATTTTCCTCTTTAGTTTATTCCTAGTGAAGTCATTAATACGTTAACGGAATATGCACCTATCACACATCCGCCAATTACACCTACAATTTAAACTACAGTGTTCATAATTTAATTAAATTTATTTTTATAGTGTTTTTAAAGTAATTGCTTAAAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,145.6 L-23,029.5 L-32,143.0 S-02,780.4 S-31,394.1
S-61,588.4 S-91,271.8 S-121,166.7 S-151,207.0 S-241,007.5
C-0476.5 C-2554.3 C-4712.8 C-61,641.2 C-8736.4
C-10493.6 C-12769.5 C-14627.5 C-16671.6 C-18622.3