Summary
Transcript IDgene_000029880
Gene IDTTHERM_00441940
Length2298 bp
Sequence
TTAAAAAAAAAACTAATATTTACAAAACAAAAGTAAAAACCAATAATTTGTATATAAAATATTACAAAATTGAAGAATAAAAAGAATCAAGATATATATATCTCTATCTATCAATATATTAATATATCCTGTAGCTTAGCAAAAATAATAAAAAGATCTCATTCTCTATAAAGTTTTTTTCAAAATAGAACCCTTTCATCATATTTCAAAAATGAACTTTACTTCCCCACTCAAGTCAAATAAAGCCAATAATCTGTTTGAAAGCCCTTCTTGCTATATGTCTCCATCCGCTTTTGATAAAAAGGGCGATTAAAATACAAATACTTTAAATGTAATTAATGCACCATTCTGCAACTCAATTCAGTAAAATAAGAGTCCTCAAAATTCTTAGTTCAAAACCCCTACAAAGTACTCTGATCGCTTTATTCCCGCAAGAACAGATTCTATTAGTAAAACTCTGTTCGATTTAAAAGATGAAATGATTGTAGAAGAATAACCTGCAAATAGAATGCTTACAGAGTCTCCTTTTCTTTTTTAAGGATCAAGATAATCTCATGCAAATAATTCAAATAGTTAGAGCACAACCATCAATGGATTTTCTAATGGACATACTCTAAATTCTTCTCAATAATTGACAACCCCAAGTAAAAAAGTCAACTTCTTAAGTTAGTAAGATGAAAACACTAAATCTTATAATGAGTTAATTCAAAGAGAACTTTTTGGTAATTACGAAGGATCTAATAATAAAAAGTCCTCAGAGGAACTTTAAAAAACACCCATTCTCAAATTTCACTGGGACTAAAAAAATGCAACTACATCTCCTCTTCTCAACATTTAGCAATCACCATTCTAGATTTCTACCCCAGATGATCGTTCAAAAGAGTAAAAACGTAAAATATCTAAAACACCTTTCAAAGTATTAGATGCTCCTTAACTCTAAGACGATTTTTATGTTGATTTACTAGACTGGAGTTCACAAAATTTGATAGCAGTAGGATTAGGAAAATCTATCTTTATTTGGAATGCTGCCACTGGAAGTGTATAAAAACTCTGTGATAGTAAAGCTTCCAACTTTGGAACTAATATCGAAAATTGCTAAAACTAATCTCAACTATCTTAATACACAAGCTTAAAATGGTCACCTAACGGTAACTAAATTGCACTCGGAAATTACAACGGATAAGTTGAACTTTGGGACTTAACTACCAGACAGCTTATTTCTGAGTTCTCTGCATAAAAAGAAAGAATAGGATGTATTGATTTCAACAACAATAATGTTTTTGCAGCTGGCTCTAAAGATAAAAGCATCCTTATTCAAGATATTCGTGACCCAAAAATTTTAAGAATGGCTAGAGGTCATAAATAAGAAATATGTTAAGTCAAGTGGTCTCCAGATCAACAATATCTTGCTTCAGGAGGTAATGATAACATGGTAGCTATATGGGATATAGCTCGTTCCTATAGCTAAAACATAAATGGCTTTGGTTCGAATGAAATTAGTCCCTACCAAAAACATAATGAACATTAGGCAGCCGTAAGAGCTCTAGCATGGAATCCTCATTAGTATGGAGTATTATTAAGTGGAGGTGGATCAAGAGATTAAACTATAAAAGTATGGAATATAAATACTAATAGTTTACTTGGATCTGTTGAGGTTGGTTCTTAAGTTTGTAAATTACTATTTTCTCCAGATTAGAATGAATTTGTTTGTGCTCATGGATTTGAATATAACAAAGTAACAGTCTGGAAATATCCTACTATGAGCTAAATCGCAGAACTTGAAGGACATTAAAGCAGAGTTCTATTTATGAGCATGGCACCTGATAATCAGACTATTGTTACTGGTGCTGGTGATGAAACTCTTAAATTCTGGAAGATCTTTTAAGGTAGACCTGTTTCTAAATAACAATCATTGCTTAAGCATTCTGATTTAAGGTGATCAAAAGTGATTGATTTATTCCTTTAATAAAACGATTTTTCATAAAAAATGTCATTTCAATTAAAAATAGCTTCGTTGCTTTTTGGCATGTTCAATAAATAATAAATAAATTGCATAAAAAAGAGATTATTAAAAAAATAATCTTTTAATAAATAAATTAACTAATTAACAACAATGAATTCAACCATAATAAATATTGTAATTAAAATATAAACCATATAATAACTAAACAAATTTACTCTATAACTTATCTTTTTAATATTTATTTTATTATTATAATTATTATTATATAAATTGGTTTTATGTATTTTGTTATAACTTTAATAATTAATTCTAAAATTTCTTGATTGCAAAAATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,189.1 L-22,829.5 L-33,633.8 S-01,615.1 S-32,978.6
S-61,693.9 S-91,913.9 S-121,422.7 S-151,547.4 S-241,441.5
C-01,626.9 C-211,907.4 C-425,443.7 C-654,643.3 C-841,953.0
C-1030,427.2 C-1213,883.9 C-149,074.2 C-1613,859.8 C-186,787.9