Summary
Transcript IDgene_000029896
Gene IDTTHERM_00442300
Length1624 bp
Sequence
TTTTTATTTTTCGAAAAAAAAATTAAAAAAACAAATTTTAATAATTCAAGAAAAAGTAAGAAAAAAATCTTGCTCATTTTCAGAAAGAAAAAAGGTTAGAAAAAGTTTATCTTCACACAAAGCTTCACAGCTCATCAAAGAACTCTATTTTTATTAATTTATAGGAAGCAACTTCGTTTCGCGTTAGAATAAAATAAATATTAAACAAGAAAAAAATCCAAAAAGTACGCATTTATCTACCTCAAATAAGCAAAATGGCCTTAGTCAACATCTAAAACATCCAATTTCATAACAACCCTTGCCCTTTTTTGAGTCCCTTTAAACTTGACGTAACCTTCGAATGTATCAAACCTATACCTGATGACATTGAATGGTAATTAATTTATATTGGTTCTGCTAAAGATGAGAAATACGATTAAGTCCTTGATAAATTCAGTATTGGGTCATTAGATTAAGGAGTGCTTTAATTTACCATTGAAACAAATCCACCTGATCACACTAAGATTCCAAACAAAGATGATTTACTTGGTGTAACTGCTATAATTCTAACTGTTTCATACCACAATCAGGAGTTTTTCCGTGTTGGATACTATGTCTACAATCAATACAATGATCAGGAACTTATTATTAATGATCCTCCTTAAATTCTAATTGATAAGGTTGAGCGTAGTATCCTTGATAAATAGCCTCGTATCACTCATTTCAACATAAAATGGGGTACTGAGGATGAAAATAAAGAAACTGACCCTAATACTTTAGCTATCCTCTAACAGTAATTAGCTTAAAATGGAACCATTCCTAATTAACTCATGCAAGAAATGCAATAAGTGAATAGCTAAATGCAATCTTTCTTACCTGATCCTTTTTCTAAGTCATCAGGAATACTCTAAGAGTTAACAACATAAGGATAGACTAACAGCACAAATAGTTTCATGTTTGGTTAAGGGCTAGACATACCTTAAAATAATGCATTCCAACCTACAAATGTATTCAGTTCTAATCCTTACTGAAAATGGAGAACATTGTAAATAAAAATAAACACATAAATTCCTTTTCTTAATACAAACAAATTTCTACATTAATAGCTATACTTAAAGGATAATTTAGCAACAAATATTATAAAATAAAAGTAATGAAATTTAAAACAATTACTCATAAATAATATAAATGCATGAAAATTGATCACTGATCTTATACAATAAATAGTATAGGCACTTTGAGCAAAATTTTAAGATCTAATAGGTTGGTTGGTTTGTAAGTAAGAAAGTAGCCACATATTTTTGAAAATTATAAAAAAAATAAATAAAATTTAGTATTAATTAGCATGAATGACTGATTATCTTGATAGAGTTTTGAATTGCATCAAAAAAAAACATTATGAGATAATAATTACATAAATAAAATAACAATCAATGCATCTTAAAATTATTCATCTTCAAATATATAAATAAATAAATCAATCAATCAATAAATAAAAAGCAAATTTAATATTTTGTTAATTCATTCATTTACTAAAATTATATATATAGATATATTTCTTTCATTCTTTATTTTTAAACTAACTATTCATCTTTCATTTATTTTTCATATTTTTGTTTCATTTCTTGTTTTTTTTCAATTCAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,765.7 L-23,901.2 L-33,740.1 S-01,031.1 S-31,690.6
S-6999.0 S-91,582.3 S-121,537.1 S-151,499.6 S-241,565.9
C-0719.6 C-220,561.2 C-444,433.4 C-652,218.2 C-827,327.2
C-1011,486.4 C-128,530.9 C-1415,983.5 C-1612,462.4 C-186,331.7