Summary
Transcript IDgene_000029938
Gene IDTTHERM_00442910
Length882 bp
Sequence
GCTTATTTAAAATTATAAATCAGGTTTGAAATAATTGATATAAATTTTTTGGCAAATATCATAGTTTACTTTTTATAAATTTAAAGGGTCTATAAACAAAAATAACCAATAACCCAATTCCTATTGCAAAATTAATATGAAATAAAAATTTGAATATGCTAAATGGGCCTTTGAAAAATGAAAAATCTTTATTATTATCTTCTTCTTATTTTGTTTGCTTTTTAGATTAGCTTATGTCATTTGTTTTTTGATGATGTTTAGTACCTTCTTTTTTTTATTGACCAACAGGATTTATTTTAGGATTTCTATTAATTCCAAATATTTTATCTAATTATTGATCTGTTTTTAACAATTTTTTATCTTTATCTTCTTGTACTTCATTTTGGTATTATTAAAACTATTCTAGTTCTAAATTATCATCTTATTATTAATATTATTGTATTTATTATTCTACTTGAACTACTTCTTCTATAGGCCAGTTGAATTTTTCTATACTCTATTCAAGTAATTATTTTTCAAATAAACAATTGTAATGGCCTTTTGTAAATAACACCGAAACAACATTAGATACTTTGTTTTCATCAAATTTATATTCGAATTAATCTGTAAAAATGCCTTCATGATTTCTATAAATATTTTTAACTTTCAAATCTACTTAGAAAGCTTTAGCTGCTATTGATATTATAACATCTTCAGCTTCTTACCCGTACTATAAAAGATATTTAGGTGAATTTGCTTTAGATTCTTCAGTAATGAAATATTAATAACTTGGATCTTTTAAAAGAAAATTAAATTTATTTAATATGATGTTCCTACATATAACCACTGTAGATACATCTACAAAAGGATGTTAATTATATTCTTCAAAAAGTTTTTTTAGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1698.7 L-2564.5 L-3720.8 S-0371.1 S-3843.7
S-6810.8 S-9612.7 S-12310.0 S-15378.6 S-24347.9
C-0244.2 C-2235.7 C-4263.0 C-6214.5 C-8176.1
C-10285.1 C-12273.6 C-14192.9 C-16330.2 C-18261.3