Summary
Transcript IDgene_000029939
Gene IDTTHERM_00442910
Length765 bp
Sequence
CAGAAATGCAAAAAGTGCAATTTAAATTCAGGAGTTAAATCAATCTAGTTTTCATTAAATTTTTCTAGTTTATATTATACTTATTTTAATTTGAAAACTTTTTAAAAAATTTTGAGTGCATCTTCAATATTTTGCTAAATAATAACCATAAACATGATGTTTATCATGAATGACCTATAAAAACAATTTCCATCACCTCTAATTTATATATGATAAGGGAAGTTTTCATCAGATTTATGATATGCGTCCTTAAGTTATTAATTGTTGATGTTTGAGTCAGCGTATTAGCTAAGTTTTCCAAATGATTGTAAGGAGCTATGCTTAAAATCAAAATGTTTCATATTAATTTCTAGTTTATGTTAATCTAAATCTTTGTTAGTATGTTCTATAAAATCTAAAATAGGAGAAATTTATTCATTGAATATTTCTAGTGCAATTTTTGAATTTAACTCTACCTTGCTTAATTTTATAGTTATGTTGTTATTTATTTTATTTTAGTTATCGCTTGAGATAGCTTGGGTCTCTTCGGGTTTCAGAATTTAATTTTAGCTAGCTTCTTCAGCTTTATCTTAAATTGTCTAATCAGTCAAGTCAGTATTAGTTTATAATTAATGAGTTTAACCAATATCGCTCATTCAATTGACACTATGTGAACCTTAATTCTCTTCAAAAATAAATATATTAAAAATGAGATATTAAAATTTGAAACGCTCTATTTTACAAATTTGTAAATTAAAAATGTTCTTCACTTTCCTGTTTTTATTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1315.5 L-2532.8 L-3427.9 S-0200.9 S-3531.7
S-6531.5 S-9414.5 S-12354.7 S-15377.9 S-24180.1
C-0152.2 C-2181.3 C-4163.5 C-6154.2 C-8144.5
C-10237.5 C-12241.5 C-14173.6 C-16231.3 C-18387.2