Summary
Transcript IDgene_000030020
Gene IDTTHERM_00543580
Length1459 bp
Sequence
CTTAGATCCTAATCCTAATGTTGGAAGAGTTAAATTCAATTTAGGAAATATGTTTATAGATGAAACATCTGGTTAGTCTTTCTTGGATTACTTTTCAGTTGCCTTGCATGAAATTATGCATATCTTAGGTTTCTCAGGTAATAGTATTTAATATTGGATTGATCCTGATACAGGTAGCGCTTATGGTTACTGGAGTGTTGAAAAAATATTGAAAAAAGAAAGAAGATGGGATATTGAAAATGTAACAAAGATATCTTCTAAAAATCTTTTGAAAGTTTCCAGAAATCACTATAATTGTCCTTCAATTGATGGCATGTACCTTGAAAATTAAGGTGAAGGTGGCTCTTTTGGTTCACATTGGGAAAGAGATTTACTTGGAAATGAATTTATGACTGCAAGTACGGTCTTTGGCTACTATACTATATCTGAATTTACAGCTGCTCTCCTTTTAGATACTGGTTATTATGCTGAAATCAATCAAAATCTCCTTATGCCTCTTTACTGGGGTAAAAATAAAGGCTGTGACTTCTTCAATAAATCATGCAACGCTGGAAAGTACTTTGCTGAATTCTCAGATGATACTACCAGAGAAGGTTGTGATTTTTACTCTTATGGTATTGGTCGTCGCTATAAAACTGATCCATTCTCGTAATGTGAAAATATTGTAATCAGCATTTAAGGTAGATGTGATTCTGATGACTTTAAATCTGAAAACTTTTTCAGATAAAACCCTGGTGCTGGCTCTAGATGTTTTAGATCAAATTCAAATGCCAAAGGAGAAAACTTTTTGAATATTTAAGGCAGATGCTTTAAGGCATAATGTTCAAACGATTTATCATCAATTAAAGTTAATGTTTGGGAAAACGAATTTGTTACTTGCTAATACCCAAATTAAGTTATTAATTTGGCAGAATAAACTAAAACTACTTAAGGTGTTATGAAATGCCCTGATGATTTTGAATTGTTTTGTGGTTTCCCTAAATAATGCCCAAATAAATGTTCAAGTAATGGTATTTGTATTAATGGATTTTGTATTTGCTTAAAAGGATATGCTGGGGACGATTGCTCTAAAAGATGTGGTGAGGATTAAGTTTGGGATGGCGCACACTGCACATTAAATTGCCCTTCTGGATTATTTAAGAATTTTGATAACACTTGCAAGACCACTTGTCCTTATAAGTAATATGGAGATTAAGCAACACGTAGTTGTGCTGTTTGCTCTAATAAATGTTCTGCATGTTTTGGTCCCTCTTCTAATTAATGTATTTCTTGCAATAACGGTTTTATTCTTTAAGGAAATCAATGTATAGAAGCTACTTGTCATTCAAGTTGTCAAACATGCTCAGGACCTAATGCCAATTAGTGCACTTCTTGTCCATCTGGAACATATTTAGACTCAAGTAAGACTTGTCAACCTTGCTAGGCTCCATGTGAAAGCTGTTTCAATTCAGCAACTGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,023.0 L-2971.1 L-3303.3 S-0115.6 S-3228.7
S-6249.4 S-9366.9 S-12370.5 S-15405.3 S-24611.3
C-01,079.2 C-21,158.9 C-4617.0 C-6397.9 C-8267.6
C-10194.9 C-12139.8 C-1498.7 C-1684.8 C-18131.2