Summary
Transcript IDgene_000030022
Gene IDTTHERM_00543580
Length991 bp
Sequence
CACGTTAATGTGAATAAGATATAATTACTTGTAGAGATGGGTAATTCTTAGATTAAAACAATAAATGCAAGCCTTGTCATTCTTTTTGCAACACCTGCGAGTAATAAAGTGATAGATGTACCAGTTGTAGACCTGGTTTTCTCCTTATATAATCCTTTTGCTATGATGAAGTATGCTAAGATGGGTATTTCAAGAACTAATAAGGTAAATGTTAAAGATGTAGTGAATCTTGCTCTAAATGTGTAAACTACTAAGATTAATGTACTGAATGTGCTAATGAATACACTTTAGACTCTAGGACATAAAGATGTATTAAAAACTCAAGCAATTAGAAATGCCATCCTAATTGTAAGGAATGTAGCTAACCAAACAATGCCCTTGCTTGTTATTCCTGCAAAGATGGTCTATTCTTAAATAACAGAAGAGAATGCGTTCAATGCGATAATTCTTGTTTGACATGTGATAGATATTAAGATTTTTGTACTTCTTGCTAATAAGGATATAAGTTAGATGCTAAAGATGGTAAATGTACTCCTGATTGTAAATCAAATGAATATTTAGATTTCTATGAAAATAAGTGTAAACCATGTACATCTCCTTGTGGAAGCTGCGAATATTATCCAGATAGATGTACTAGCTGCATTTCAGGATATAAATACGACAACGAAGGGTATAGTTGTGAAATCATTTGTCAACCTGGATAATATGCTGATAGAGATCAAATATGCAAACCTTGTTCATCTCCATGTGCAACTTGTGAATACTATGATAATAGATGTTTGAGTTGTGTTTCTGGTTATACTTACACCAACTACAATTGTTAATAAACTTCAAGGCCTAGTATGAGAGGTTGTCATGAATCTTGTAATACATGCACAAGAGCTATGGATCCTCGTTCATGTGACTCTTGTAGAGAAGGATATGTACTAATGAGTGGATCTTGCCAAAAAAAGAAAGGAAATTATTCTAACCCTAAAAATTGATATATTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1126.5 L-290.4 L-331.4 S-028.7 S-333.8
S-635.5 S-948.9 S-1264.2 S-1545.0 S-2465.6
C-0118.8 C-271.8 C-483.9 C-685.5 C-897.8
C-1060.0 C-1249.1 C-1442.3 C-1636.0 C-1858.1