Summary
Transcript IDgene_000030475
Gene IDTTHERM_01166280
Length1566 bp
Sequence
TATCTTCTTATTATTATGGAAGCTAAGAGAACTTGCTCTTAGACATATATTTTTGTATTTCTTCCATTTTTTACATATCGAGGTTATCGGTTTGATATTCGATTTCGTTGTCAGAGTCAGCTTGAGGTATTTTAACTCCTTCGTAGCGGGTTGCGGGGGGAAGTTCTGAGTTTTTCTCAGATTAAATGATATTAACTTTAGTATTTTGGTAGTTGATATTGAATGTATTCAACTCTTTAAGTTATTGAGATGTTTCGTTTTCATTGTTTATTAGGACATTTGTTTTGGGGACAGTTTCTGCTACACTTTCAAATTAGTCATTTCCAATGTATATTTTTTTGCTGTCGCCTAGATGGGAAGGTCTGTCAGGTTCTTCTCCAAATACTCCTTTATTCGTGTGGATTTTGGATTGGAGTTGAGACTCTTTTTCATAAACACTGATTTTTTTATTTTACTCTTTTGGGAGTTTGTTTATTTTATTGATGCTGTTGCTGTATTCATTCATTTCATCGTCATTAAAATCTTCGTTTTCTTGCACAAACGCATTGACACTAGTCTACTTCGCTTTATCATTTTAATCGCTAGATGGACTGCCTTTTTTCTTATTATCACTTGCGGCCTAGCTATTTTAACTAAAGGCTCTTTCTTCGTCTTCATCGTTATTTTCCATAAAATTAAGTTGGTTATTGGCATGTATTTGAGGATGATCAGAAATCTCATTTTTAATAATGTAAAATTGCTTATTTTTCTAGAACACAGTCAAAGGATGATCGTTTTCTTGAGCTTTATTTGATTAGTTTTAAGAAGATTCGCTTAAATTTTTAACTAAAATGTTGTCACTGTGATTATTAATTAAATTATTATTACTAAGCTAATTGGCTGTATGCATATTAGAGATTATGTTATTATTTTAATAAGCATTATTTACAGCTAGAATGTTGTTATTGTAGTGATTTTTAATTAGACTTCTTGTGCTCTCATTATTGTGATTGATATTTTTATAGGTGACCTATTTATTATTAAAATTCACCATGTTACTTTGTTCGCTATGAAGCACGCTCTAATCATTATTTTAAATAGTGATGAAATTTTAGCTTTGAGGTTTATTTAATTTTCTTCCACTGCCTTTATCTAGATCATGATTCATTTAAAGTTTTAAATCAGTAAATTCGACATTTAAATTTTGTTAGTGTTCCACATTTTATAAAGACGCAGTCCTCTTTGAAGCCTTTTCTTATTTATGTTCTAATTCTACAGATTTTTTAGATGGATTTTAGAGTGCAATTTCATTTTATTGGATATTATCTGCAATTTCGATTTGTAAACCATTTTCAGGAGTAGTGTAGGCATTATTATTGTTGTTGTTATTTTTAGCATTATTGCTATTATTAATATTAGGATCAGTTTATTGATTTTTAACTTACTTCTCAGCTTCGTTTAACTTCTTTCTGTGATATTGCAAATCATGAACTAATTCTGGAGCAAATATGTATCTGTAAACTTTATATGTGTATTTAATAATACAGATAAAAGCAACATTTAAGAACAAAGTCAACCAGAATTTCC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,268.3 L-21,076.0 L-31,287.2 S-0803.2 S-31,077.4
S-61,249.9 S-91,448.3 S-121,469.1 S-151,697.4 S-242,034.0
C-01,568.0 C-23,302.2 C-42,329.1 C-63,101.2 C-81,886.9
C-102,672.1 C-123,091.7 C-142,410.5 C-162,024.4 C-182,049.1