Summary
Transcript IDgene_000030499
Gene IDTTHERM_00728900
Length1639 bp
Sequence
TCTACCTTCACCTATTAGACAACTAATAAAAATGGAAAACGAGATATACTGCAGTATCCATAAAAATAAATTAATTGATGCTGTTTGTCTAGAAAAAGAATGCTCTGAAAACTCTCTAATATGCTATAACTGTAGAGATACTCATCAAGATCATATTTAATCTTGCATTCATTTGTAAGATCTCATTGAGAACATCGAGAGTAGATTTAATCTATCTGTAGTAAGTAATGAATTTAACTTTTAGCTGAATAAACTTAAGTTTCTAAAAGAAGATTACTAGCAAAGAATGAATAAGCAAAAACAAAAAATTACATAATTGATTGATAAATCCCTAAAAGAATTCAATAAATCAATAGATTGTAAAATTTAAAACATAAAATAAAGCTATCATTCACACATTTAATTTATGTAGAAGTTCAGAAATTTTGGAATGAACAAGTAAAAAGAAAACATTTTTATCCTTGAATAGGCTAAAAATCAATTTAAAATTTCCAAGAAAAATGAAAAAAATAATAGCTAAATGTTAAATAGCTTAGATCGTAGGTAAAACTCCTTAGAAATTGTGCATCAGGATCTCATTAATAAAGAGTTCTAGTAATCTCAATAATATTATTAATAGATAGCAGATGATGTAATTCAATATATGAATAATTTTGAAACATTATGGAGAAATCAAACTAAAAATTCTGCCTTTATTTAAGAGATTAGCTCACCCTTAACAAATAGCAGAACTTAAATAAACAACACTTGTTTATAGAAAATACATTAAGATATTGAAAATGGTATTTTAAAAAAAGAAAACCCATATCAACAATTTTTATAAAGTAGTTCTAAACAAAATTAATAAAATATTCATAATTAAATTTACGATGATGAAAAAAGATAAATTGATTAAACTTTTAAAAATAATTATATCAACAGAGATTACGAACAAAAATTTGAAAACAATGATTAAGTTGTCCAAATTAATGCAACCAGATGTGAGCAGTCACCTAAAATTTTAAAGGAAGTTTAAGCACCATTATTTGGCAATTTTTAGCAAAGCATTATATTTAACTAAAATTAAATCAATGACGATTTATAGCAAATAGGTTCTTAAAGATTATATAATGATAAATAGAATTGCTTTTAAAACTCATCATTAATGAACACTAAACCTCAGTAAAATTATGGCCTTGAGAATTCGTAAGCTATAAAATAATATACATTTAGCGATGAATAAAAATTCAATAGAGCTTCTTCTGAAAATTTAGCTGGAAAAAAATCAATAAATTCTCAATCAACAAATACTCATAAAAGTAGCAATAGATACTAAAGTAAAGAATAGAAATCTTAAGATTAATAACAATAATCATAATTAGATTCAAAATAAGCATAAGTTTGATGTTTAAACTTAAAGAGCAGCTAATAATATAAAATGCAACAACAAAAAAATTAACGAAAAATTACTTTTTTGAAGAGAGTGGCAGCAAGATTCATCAATTTAAAAAAAGAGAATTTTTATTTTTGAATAATTTATGTCATTAAATAATTTTTATCTAAATTAAAAAAGGTATTGAAAATATAATTAATATTTATTTTTTGATGTGGTTGTTTTATAAAATATATTTATTGTTATTTTGATAATGAGGAATACATG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-124.5 L-230.7 L-334.2 S-034.2 S-331.5
S-634.5 S-940.9 S-1239.2 S-1529.7 S-2434.3
C-028.8 C-219,175.0 C-46,148.7 C-61,963.9 C-8549.0
C-10518.3 C-12912.0 C-14658.5 C-16152.7 C-18128.0