Summary
Transcript IDgene_000030541
Gene IDTTHERM_00621060
Length707 bp
Sequence
GGAAAATCGTAAAAATTTAATAGCTAAAATAGTTGCTTAAACTGTCATGGAGGGAGCTTCAAATTAAAAAATTGTTTACAAAACAAGAGGAATATTAACCAAGGTTGGTCGAGCTATAGCCGTAGATTTATCAGATTCCAATTTACCTCATGATTAGGGTATCAAACCTCACATGACAGTAGTTTTTAGCAAGGAACGTTTTACTTAGGAAGACATTAACGAACTCTATTCTTTAGAGCAATAATTCAGAATATCCTAAGGTCTTTAGCAGGATGAAAATTATAGCTTTGTCTTAGAAAACTGGGGTCCAAGATCTAAAAAGATTTAGGGCCAGCTCTATGATCTCTGCATCTATCTTCGTTAGCACTTCACAGGAGACTCAACTGATGAGAGAATTCCTCATGTAGAACTGAAGAAATTAGAGAGAAACAGAAAATGAAGCAAGCAAATGATCATCATCTATATCAGCTAAAAGCGGTCTATACAAAAATAATAGTTATAGTCGCTATTTTAAATTAAGGGTGGGTGGTAGGCATAAAAAATCAAAGCTAGCAACAATTTAATAAATATATAAATAAATAAATGTTAGCTACTTAATCTTAAATGAAAATTAAATAACTTATTAAAAAATGAATGTTGATTATTAAATATTTCGTTGTTTTGTGTTCAGTTGTTTATTCATTCATTTAGTTTATAATTGAATAGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1379.8 L-2388.6 L-3400.9 S-01,086.0 S-31,015.3
S-6887.2 S-91,310.5 S-121,746.3 S-152,614.2 S-241,599.1
C-0239.9 C-2468.5 C-4418.4 C-6379.9 C-8287.3
C-10412.5 C-12432.8 C-14355.5 C-16432.5 C-18605.4