Summary
Transcript IDgene_000030588
Gene IDTTHERM_01513300
Length327 bp
Sequence
TTGATCTTAGTCATTCTATTCTTACTTAAAGGGAGATATGTAAGGAATTTTTTCAAATTTTTTTTTGAGCTCTTCAATATATATATTTTTGTAATAACTCTAAGGCTACAAACCTTTTTTAAAAACAACATTCATTTATATTAACGCGCATTTTAATTCATTAGAATTCATCCTGCTTGCCTTTAAAAGCTCCTTTTTGAGTTGCGGATGCTCACTCATTATTATAGATTGATGTTTTGGTACCTATTAAGCTCTAATTTATTAATTTCAATTTTTTAAAATATCAAATTTAAGCAGGTTATTATTGGCGCCTAGAAAATATCTTCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1144.4 L-278.3 L-381.5 S-037.4 S-331.7
S-630.7 S-930.5 S-1261.8 S-1543.3 S-2450.6
C-027.6 C-2241.1 C-4681.7 C-6871.1 C-8273.4
C-1088.0 C-1277.5 C-14140.7 C-16130.3 C-1862.4