Summary
Transcript IDgene_000030797
Gene IDTTHERM_00145630
Length550 bp
Sequence
AATAGATAGGTTCTTATACGAAAGCTTTACTATCTAAAATAGATGATGCATTATCAGAATGTAAAAAAATTTAAAAGCCTATTAGACTTTAACTAGAAGCTCATCAAATCAGCATACTTTTCTTAGTACCGTTGTGTAAAAGTCTAATTTCCTTTCCTAATTTAGTTAGCCTTTAACTAAATTTAAGCAAAAACTATTTAAATATGAATGCATTGCAGGATTTAGGGTAGGCAATATAATTAACAAGGAATGTAAGATTTTGGGATATAGATTTAAGTTATAATCCTAAGTTAGATAATATTGGACATCTAATACTCTAAGATTTGAGTTAGTTGAAATAATTAGAAAAATTATCAGTATCTTTGAATAATACTAGCTAAAATAGTTAGTGTGCTTTGTTTGCAGCAAAATGTGTCTGTAATAATAAACAAACTTTAAGATAAATAAACTTTTAATTTAGAAATTGCTTTTAAATTTCAGATGATTCTATTCGTTCTTTATTTAATTAAATATATGAAGTAGAATTAATTAGCTCGCTTGGATTAGGTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-190.5 L-2120.8 L-365.2 S-087.1 S-367.1
S-642.7 S-938.8 S-1251.1 S-1544.4 S-24162.0
C-046.4 C-2121.9 C-4276.5 C-6141.3 C-8191.8
C-10568.1 C-12856.9 C-14794.2 C-16210.7 C-18174.3