Summary
Transcript IDgene_000030857
Gene IDTTHERM_00746920
Length589 bp
Sequence
AAATAAACATAATCTGAGTCTATCAGCTTAGTTTTATTTCTTGTGCTTTTTTGTCTCAGTCCAGTCACTTATTATCCAGATTTTTCACTCTTTGAGTCGTTATTGTTAGTCTCCTAATTATTCTCTTAACTCTCAAGCTCTATGACTTAGCTCTATTTAACATTCCCTTTTTGCTTTCTTTATTTTTACTCTTGCAACTTCGCTTGCTGCTTTCTTGATTATTTCGAACCTTGCTGAGAAGAAGTAGCTTGTATCTACTTTGAAGATTCGTTGGTTGTTTCCTTAATAAAATAGCTGAGATCCTCTTCTCTCTTGTAATTGGAAGCAAATTTATTGAGATTTCTAAAAGGGAATTTTATCATATTCTTAAAGCTAAGTTTTTCTTGAGAATTAGATGATAGATTGACTTTGTATTCTATGAGAATATCGCTAATATCAATGCAATTTTATATTTTCACAGAATCATCTACCAAATCTGGGTTTTTAATCTTGTTGAATTAATCTAAATGCTTGTGGATTGAAATAAAAATATTTTCAAGCTTGATCATCTTTGATTTCATAAACACCACACTTTGATGCAGCTTAAGAA