Summary
Transcript IDgene_000030909
Gene IDTTHERM_00966510
Length561 bp
Sequence
ATTTATTTAAGTAAATGATGTCCTAACACAACCTGTTTCCAATAAACCTCTCTTTTACTGCTCTTCCTGTTTTAATCACGATCTTCACTTTAAATCTATCAACTATCTTATGATTGACCAGATTTTTTAAGAAGCAGAAACTAACATCATCCCAAAATGGCCACCAGTCAACAACTATCAAATCATCTCAGATCTCATTGATCTTAATTCCAATTAATCTTCACTTGACTATGTCAAGCAAATTACAGACTTCTTTAATTAATTCAAAGAAGAGTTTTTAAATAAAATAGATATCATCTAAAAATAGACTATCAATGAAGCTTTGAAATATCCTATTGATACACAACAAATCATCAAAAGATATTAGGAAATTTCAAACATTCTTTAGTTTAAGTAGATTCTTAACAACGAATAATCAAATAACCTTCAAGATCATTCAACTCTTTGTAAAGAATTTATCTCATAAATGGAGTCTCAAAAAGATAAAAACACTGAATTATTGTAAAGTCTACTTACCTAAGCAAATTAATTAAAAACAAATTTCAACATGGAATATCCTCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,458.4 L-21,625.0 L-31,729.3 S-0476.0 S-31,926.8
S-62,307.7 S-92,034.3 S-121,574.2 S-151,127.1 S-241,017.8
C-02,189.7 C-2979.5 C-41,186.5 C-61,247.5 C-81,406.5
C-10488.8 C-12961.3 C-141,145.4 C-161,446.5 C-181,978.3