Summary
Transcript IDgene_000030910
Gene IDTTHERM_00966510
Length343 bp
Sequence
CCTGAAGTTAGTAGTACAAATCATAATAACACTGGAAATCATTAGGAAACTAACATTATAAATCAAAGTAATTTTGGAGATTTAAAACTAACATCTGACTTAATCATGAAGCTTGTTTCTAATAAATCAAACTTTTGCTCTGACTAATTCTTAAACAAGCTAAGTGAGATTCTTTAAAGAATAAACCCTCTACTTAAATAGTTTACTTTCAACACAGCAGTTTTCAAGGAGAACAAAGAACAAATTGATTTTTCCAAGATTAGTGAGGAAAAAATAAATTTGATAGAAGAATATGTAAAGCATTCAATTGCTTTGTCAAGAGGGGAATAGTAATATGAATAGG