Summary
Transcript IDgene_000030911
Gene IDTTHERM_00966510
Length733 bp
Sequence
AGTTGATGTAAAACCTTTCTTAAAATAGATTAATTTCACTAATACTTTTACTGACAAAAATAAATTTGATTAATTCAGAAAAAAATATTTGAAAGATAAATAATTGTGTGTTTTATTTGATGAAATTTAATTCATTTCAGATCTAAAATTGTTTGCAACTTAGTTTAAGAATGGGTAGAGAGATAGTGTGGTAAATAAGAGAGAAAATGGTTATTATGAAATTGAAAAATTAAATAATAATGATTGGGTGAATTGTATATCAAATACAAATTTATAAAAAGATTAGAAGTATATTTTTAGGATAAAAGTTGAAAGTCTAAATGAAGGTATTTATTTTATGATAGGTCTAATGAGAAATTTAAATGCTGATTTAAAAGTAGGATATAATGATTATTTAAGTTGTTACTTAAAGAAAAATAATCAATCTGTAATTAAACATGGAGGTTTGGGTATAGATAAATAATTAAAGGGAGCAGGATTTAAGACGAGTGGAGAGAATATGATAGAACTAAGATTGTGCTTGAAAGAGTAGATTTTAGAAGTGTTAGATTATCCTAATTATGAGTATAAGCTAGGATTACAAGATTAATATAAAGAGAAGCTTACATAATTTGATGATCTAAGATTTTATCTTGGTATTTATGATTAAGGAAGCAAATTAATTTTAATGGATGTAAAAATAGTGAACGAGTTTATAATTTGAATTAAATTATATTTATATTTTATATAGAGT