Summary
Transcript IDgene_000031008
Gene IDTTHERM_00329900
Length556 bp
Sequence
TTCAAATTTAATACTAAAAATTTTAGTTTTAGTTATAAAACAGTATCATAAACTAAAAGATATGAAATTTTAAATTCTATTACTTTTATTTACATGGATTGTTATGGTATTTTCAGATCAGGATTTAAGCGGTTAAAACGTTAACTGTATTGTAAATGAAGAATGTTCAGATAATGCAAACAGCTGTGGTATGGCTGGTGTTCCAAATAATTGGACAATAGATAAAATTAATGGTTTATGCAAAGTTAAAGATTGCACACAACTGTAAAATTCTAATGTTAGTATATCTAACTCTGCCTGTAAATCCTGCAATACTGATTAAGGCAACTAATAATAAAACAATGGAAACATATTCTCAAATTCTGCAGGAAGCAATTGTGTTAATATAAATTGTGCTTAATTAGCTTTTGATGGAAAAATGAATGATAAGTCATGTGAAACTTGTGTTGGCTTAGGTTCTAAAGTTAATTATGATAAGTCTACATGCATTCTACCAAATTCTATTTTGAATTCTAAAATAATTCAAGTAACTGCTTCCTTTTTAGCATATCTACTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1605.5 L-2621.1 L-3623.7 S-0963.1 S-3581.1
S-6855.1 S-9401.7 S-12249.6 S-15234.9 S-24309.8
C-0247.2 C-2129.1 C-4128.6 C-6164.1 C-8106.5
C-1083.5 C-12153.3 C-14151.2 C-16249.0 C-18197.3