Summary
Transcript IDgene_000031140
Gene IDTTHERM_00138470
Length698 bp
Sequence
AAATGATCAAACTTATTAATTAATTAATTATTTTATTTTCAAACATGTATTTTCCTCATTGCCTTTAGTATTTTATATTATTTATTGGAGGGTGTTAAAAATTAGGTTGAATTGATTAAAAATACATAGGTTAAAGGCCTATAGGTTGTGGAGGTAGATATTATACATATTGATACTATGGATTTGGCATTACCATGTGCATATTAGACTGATATTAAATTGGCTAATAATATGGAAAAGTATTTGAAGAATTTGGATAAGAATATTAAGGATTTATAGAGTTTTATTAAGGCGATTCACTAGCTTAGTGTATCATTTAATCTTATTCTTTATACTCTGGATAGCTATAATAGTTATCATTTTAATCATCACTTTCAAAAGTTTTAAATTAAATATTTTATTAAGCTTCATATTTTAAATTTTATAAATTTTAGCTTTCTTAGTATTTTTCAACTTTAATTTAGTCTTTCTTAATCAGATAAGAACTATCAATAGATTTTTTATGAGACTTCTTTAATTCACTACTCTCAAAGAATTTTTAATCATACTATTCATCTATTTACTTAACGTAAATTTCAGAAAACTTAGGAGGTAACTCACTTTCATTTCCATATTAATGATTGTGAAAGTTATTTTTACTAATTTTATGATTTTTTTATTTAAATTCAAGAAATTAATTTTAATTATTTTCTTCTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1492.9 L-2474.1 L-3475.2 S-0700.6 S-3764.1
S-6875.8 S-9645.5 S-12592.4 S-15690.3 S-24689.2
C-0867.4 C-21,818.0 C-4933.0 C-61,280.9 C-8598.3
C-10935.3 C-12791.5 C-14758.8 C-16622.4 C-18846.6