Summary
Transcript IDgene_000031291
Gene IDTTHERM_00522250
Length1071 bp
Sequence
GATTTTGAATAAAAACACATTATTTATAAAAATGAAACGATAATCTTTGATTGTTTTTCTAGAAATATTTTACAGTTAATTCTAATTATAAAAGGTTTTTAATATTATCAGATGTAAAATTAAACTATTGCTGCTTATACTGTAAATCTTACCAAATATTATACTGCAGTAATTATTAATAATAAACTTTAAACATTTCACATAAACATTCCTGAGTTGTATAAAATTTCATTGAGTTTTTGAATAAGAGGTCTTGCATCTTGAGCTACTATTTCTTAGCTTAATTAAGGATAAAGACTGCGAACAACCTCAAATGCTTAAATATCTTTGAAAACATATTGTTATTCTACTGGAGTTAAGAGTAAAACTTCTCCTCTAATTCCTGATAACTCTAAATGAGTCACAATATCACCTGTAATATCATAAAATCTGTTACCTACAGGTATTTATTCAATATGTGGGAACAAAGAGCTGCTTTAAGAGTTCGAAGTAGTAAATTTTGACAGGGCAGGATTTTTTAGTTATGTAGCTTTTTTAGTTGAGATAATATACTCCTAGTTAATTGTATCTAAGATAACAACACTTTCCAAATGAGAGCCATCAACATACTAAAAGAAGAATTCACTAAATTTGAATTCAAATTCTTCAATTGAATAATTAAATATTACAACAAGTAAGTCAGGATTTGAAGTAGAGATGTAGAAATTAGCTAAATATAACTGTTTTTTTTTAGAGAAATTCAAATCTGCTACCTTTTGAAAATCTTTGTTTTTGTTTACTTTAGTTTGAAGGAATATTTAAGGGTGGCCATTATTTGCAAAAATAATTTTCTTCACTTAGAATTTACCACCAAGCAGCTTTTATTTGTAATCGGCAGCTATTGTTAAGTTAAATTCAAATACATTAGGCTTTTCTTCAACAAAATCATAGTCGTTTTCACCTATTTCTATTTTTTATCCTTCAATTTTTAATTGGTTTATTGCTGTCTCTATCTCCATTTATTTTCTAATTACTTTGAATATCTATTACTGATGACTTATTTTCAATTTTTTGATACTTAGTGAATTTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,536.6 L-22,240.9 L-32,416.8 S-02,658.4 S-31,443.8
S-61,373.2 S-91,307.0 S-121,942.3 S-151,985.6 S-241,848.6
C-0474.3 C-2499.9 C-41,781.9 C-62,067.6 C-81,567.4
C-101,489.0 C-121,182.3 C-141,608.5 C-161,654.4 C-181,395.9