Summary
Transcript IDgene_000031451
Gene IDTTHERM_00922960
Length1096 bp
Sequence
CTTAGATTGACAATGATTAGTAATCCTCATAAAATGCATCAACTAAAATCTCTGAAAAAAGTAGTGGTTTTAGCAACCTTAAAATGAATGATATACTAGATTTTGATTCAAATAATTAGTTAAATCCTGATAAGTCTGAATTCAAGATTAAAGATATTTTAAATATGCAAAAAAAAGAAAAGGAGGACATATAACAACTTCAAGATAAGCTCATGAAAGAAACAATTTAATTGGGGCTTCATAAGAAGAAAATACCTAATACCTCTTCTTAGAGCCTATCAACAAATTAATAAGAATAAGGAGTAGAAAGCGAATCTACTAAGAAAGCAGATGAAATGCTCTATAAAAAATTATCAAAGAAATGGGGTTTAGACAAGATTGATGAAACTGATGAAGAAAAGGCTTTTATGAAAGATCTTTTGGATAAAGATACTAAAATAAATCCTGAAAGTCTTTTCAATAAATCAAATTTACCATAATCTGAAAAAGAAGCACGTGAAAAGTTTATTACTTAACACAGCTACTAACCTATGAAAAGAAAGAATATTACTGAATATAATTCACGTTATAGCCATGAAATAGATCCAATGATGTAAGGATCTCCTCTCGATATAAAGAGCGATGAAAATCCTAAAATTATGAGATACATGGATGAATTTAGGGAATTCAGACCTTAAATAAATATTGGTGAAAGGTGGGGTTAAATTATTTAGCAATCTACTATCTCTCGTATTTAATATGAACAATAAATTGCAAAGGGAGGTAATTTAGTTTCATACATGGCTAAAACAGGAAAACTTGGAGTTGATTTGTACTTTATCATATTTGGTATCACTGGTCTTTTCATTATTCCCTATATGGTTTACCAACACCAAAAATAAAAAATAAATTATGTACAAAAAACTAAGAATATAAATCCTAAAACTGTTCCTGATTTTTACTATACAGACTACGATCTTGATGAAATATCTGTATAGAAATCATTTTATAACTAGTACACAGATGAAATTATGGAGGAAAAAAATAAAAAACTAAAAATGCACAAGGAAATCTAGTAATTAACTAATATGCTTTTTTCAAACAAATGATGAGCGAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,270.4 L-21,367.5 L-3977.8 S-0320.6 S-3163.7
S-6123.7 S-9174.2 S-12171.9 S-15236.2 S-24126.4
C-069.5 C-2163.3 C-484.2 C-6126.9 C-8169.1
C-10356.1 C-12252.7 C-14124.8 C-1674.1 C-1856.6